Sequence ID | >WENV180097247 |
Genome ID | MTBK01176137 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1110 |
End posion on genome | 1184 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
agttttttga |
tRNA gene sequence |
GCCGGCGTAGCTCAACGGCAGAGCAACGGTTTCGTAAACCGTAGGTTATGGGTTCGATTC |
Downstream region at tRNA end position |
ctgagtctca |
Secondary structure (Cloverleaf model) | >WENV180097247 Thr CGT a TCCA ctgagtctca G - C C - G C - G G - C G - C C - G G - C T T T T T C C C A A A A | | | | G C C T C G A T G G G C G | | | | T T G G A G C C A A AGGTT A - T C - G G - C G - C T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |