Sequence ID | >WENV180097250 |
Genome ID | MTBK01176417 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 81 |
End posion on genome | 165 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcggccgcca |
tRNA gene sequence |
GGGTCGGTGCCCGAGTGGCCAAAGGGAGCGGGCTGTAAACCCGCCGGCTCAGCCTACGGA |
Downstream region at tRNA end position |
gcgattcgat |
Secondary structure (Cloverleaf model) | >WENV180097250 Tyr GTA a ACCA gcgattcgat G - C G - C G - C T + G C - G G - C G - C T A T C T T C C A T G A G | + | | | A G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCTCAGCCTAC G - C C - G G - C G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |