Sequence ID | >WENV180097268 |
Genome ID | MTBK01177183 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 106 |
End posion on genome | 26 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caacagttaa |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGCAGACGCACTAGACTTAGGATCTAGCGCAGCAGCGTGGGGG |
Downstream region at tRNA end position |
acatttgacc |
Secondary structure (Cloverleaf model) | >WENV180097268 Leu TAG a ACta acatttgacc G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C C A G A CGCAGCAGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |