Sequence ID | >WENV180097272 |
Genome ID | MTBK01177720 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 579 |
End posion on genome | 661 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gatagataaa |
tRNA gene sequence |
GGAGGGTTGGCAGAATGGTATTGCGCCGCTCTCGAAAAGCGGTGGGTGAAAACCCTTAGA |
Downstream region at tRNA end position |
ttgttttaat |
Secondary structure (Cloverleaf model) | >WENV180097272 Ser CGA a GCta ttgttttaat G - C G - C A - T G - C G - C G - C T - A T A T T C T C C A A A G | | | | | G T G A C G A G A G G C G + | | | T T G T T G C T A G TGGGTGAAAACCCTT C - G C - G G - C C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |