Sequence ID | >WENV180097276 |
Genome ID | MTBK01177777 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 599 |
End posion on genome | 506 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttttcgcctt |
tRNA gene sequence |
GGAGAGGTGACGGAGTCCGGTCGAACGTGCCTCCCTGCTAAGGAGGTGACTGCCGCAAGG |
Downstream region at tRNA end position |
aaaatgtgat |
Secondary structure (Cloverleaf model) | >WENV180097276 Ser GCT t GCCA aaaatgtgat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C T G A G | | | | | A C G G C A G T G G G C G | | | T T G A C G T T C G A G TGACTGCCGCAAGGTGGTCC C - G C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |