Sequence ID | >WENV180097305 |
Genome ID | MTBK01180331 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 288 |
End posion on genome | 205 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgttttttga |
tRNA gene sequence |
GCCGCGGTGGCGGAATTGGCAGACGCGCTGGACTTAGGATCCAGTCCTTAATAGGGGTGC |
Downstream region at tRNA end position |
ctcaaattga |
Secondary structure (Cloverleaf model) | >WENV180097305 Leu TAG a ACtt ctcaaattga G - C C - G C - G G - C C - G G - C G - C T A T C G C T C A T A A G | | | | | A T G G C G G C G A G C G | | | T T G A C G C C A G G TCCTTAATAGGGGT C - G T - A G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |