Sequence ID | >WENV180097313 |
Genome ID | MTBK01181064 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8435 |
End posion on genome | 8345 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gatcgctcgc |
tRNA gene sequence |
GGTGGCGTGTCCGAGCGGCCTAAGGAGCACGCCTCGAAAGCGTGTGACGGGTAACCCCCG |
Downstream region at tRNA end position |
taaccacccg |
Secondary structure (Cloverleaf model) | >WENV180097313 Ser CGA c GCCA taaccacccg G - C G - C T - A G - C G - C C - G G - C T A T C T C C C A C G A G | | | | | A G G C C T G A G G G C G | | | T T C A G G A C T A G TGACGGGTAACCCCCGTCC C - G A - T C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |