Sequence ID | >WENV180097322 |
Genome ID | MTBK01181530 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 770 |
End posion on genome | 855 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taatgaaaaa |
tRNA gene sequence |
GCGGAGGTGGCGGAACTGGTAGACGCGTATGGTTGAGGGCCATATGACTTTAGGTCGTGA |
Downstream region at tRNA end position |
tttagaatag |
Secondary structure (Cloverleaf model) | >WENV180097322 Leu GAG a ACCA tttagaatag G - C C - G G + T G - C A - T G - C G + T T G T T T C C C A C A A G + | | | | A T G G C G G A G G G C G | | | T T G A C G C T A G G TGACTTTAGGTCGT T - A A - T T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |