Sequence ID | >WENV180097328 |
Genome ID | MTBK01182163 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 622 |
End posion on genome | 711 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcaagacct |
tRNA gene sequence |
GGAGTGGTGGCCGAGCGGCTAATGGCGCACGCCTGCTAAGCGTGAGGGGCCAAAAGTCCC |
Downstream region at tRNA end position |
actcggcccg |
Secondary structure (Cloverleaf model) | >WENV180097328 Ser GCT t GCCA actcggcccg G - C G - C A - T G - C T - A G - C G - C T A T C A C T C A C G A G | | | | | G G G C C G G T G A G C G + | | | T T C T G G C T A A G AGGGGCCAAAAGTCCCAC C - G A - T C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |