Sequence ID | >WENV180097334 |
Genome ID | MTBK01182590 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2304 |
End posion on genome | 2232 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tagaacttac |
tRNA gene sequence |
GCGGGCGTCGCCAAGCGGTAAGGCATTAGCCTTCCAAGCTAACATTCGTCGGTTCGAATC |
Downstream region at tRNA end position |
tttttttaat |
Secondary structure (Cloverleaf model) | >WENV180097334 Gly TCC c TCtc tttttttaat G - C C - G G - C G - C G - C C - G G - C T A T T A G C C A G A C + | | | | G C A C C G G T C G G C G | | | T T G A G G C T A A CATTC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |