Sequence ID | >WENV180097354 |
Genome ID | MTBK01183732 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 24549 |
End posion on genome | 24633 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agggcaaagt |
tRNA gene sequence |
GGTGGGATGGCCGAGTGGTCAAAGGCAGCAGACTGTAAATCTGCCGACTCCGTCTACGAA |
Downstream region at tRNA end position |
cttttgtaag |
Secondary structure (Cloverleaf model) | >WENV180097354 Tyr GTA t ACCA cttttgtaag G - C G - C T - A G - C G - C G - C A - T T A T C T T C C A T G A G | | | | | G G G C C G G A A G G C G | | | T T T A G G C C A A A CGACTCCGTCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |