Sequence ID | >WENV180097356 |
Genome ID | MTBK01183732 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 54651 |
End posion on genome | 54727 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
cttcaaagga |
tRNA gene sequence |
GGGCCTATAGCTCAAGTGGTTAGAGCCACCGGCTCATAACCGGAAGGTTCCTGGTTCGAG |
Downstream region at tRNA end position |
tacttttttc |
Secondary structure (Cloverleaf model) | >WENV180097356 Ile2 CAT a ACCA tacttttttc G - C G - C G - C C - G C - G T - A A - T T G T G G A C C A G A A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T T A C AGGTT A A C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |