Sequence ID | >WENV180097357 |
Genome ID | MTBK01183732 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 200903 |
End posion on genome | 200989 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
ccgtcgttgc |
tRNA gene sequence |
GCGGGGGTGGCGGAACGGGTAGACGCGCAAGGCTAAGGACCTTGTGGCTGCAAGGCTGTG |
Downstream region at tRNA end position |
tgatagcaga |
Secondary structure (Cloverleaf model) | >WENV180097357 Leu AAG c ACCA tgatagcaga G - C C - G G - C G - C G + T G - C G - C T G T C C C T C A C A A G | | | | | G G G G C G G G G A G C G | | | T T G A C G C T A G G TGGCTGCAAGGCTGT C - G A - T A - T G - C G - C C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |