Sequence ID | >WENV180097368 |
Genome ID | MTBK01184558 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2611 |
End posion on genome | 2700 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgatattata |
tRNA gene sequence |
GGAGGCGTGCCAGAGTGGTTGAATGGGCCGCACTCGAAATGCGGTATCCCATTTTTGGGA |
Downstream region at tRNA end position |
attttcaaaa |
Secondary structure (Cloverleaf model) | >WENV180097368 Ser CGA a GCCA attttcaaaa G - C G - C A - T G - C G - C C - G G - C T A T C C T C C A T G A G | | | | | G G G A C C G G A G G C G | | | T T T A T G G T G A G TATCCCATTTTTGGGATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |