Sequence ID | >WENV180097370 |
Genome ID | MTBK01184658 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12083 |
End posion on genome | 12157 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aatcagattT |
tRNA gene sequence |
GCCAGCTTAGCTCAGTCGGTAGAGCAACGCACTCGTAACGCGTAGGTCACAGGTTCGATT |
Downstream region at tRNA end position |
atatagtaaa |
Secondary structure (Cloverleaf model) | >WENV180097370 Thr CGT T ATaa atatagtaaa G - C C - G C - G A - T G - C C - G T - A T T T C G T C C A T G A A | | | | G C C T C G A C A G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G - C C - G A C C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |