Sequence ID | >WENV180097389 |
Genome ID | MTBK01186036 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1104 |
End posion on genome | 1029 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
atatcttaga |
tRNA gene sequence |
CGCGAGGTAGAGCAGCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
ttttttaaca |
Secondary structure (Cloverleaf model) | >WENV180097389 fMet CAT a ACCA ttttttaaca C T G - C C - G G - C A - T G - C G - C T A T C T T C C A C G A A | | | | | G T C G A G G A A G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |