Sequence ID | >WENV180097396 |
Genome ID | MTBK01186565 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 13149 |
End posion on genome | 13063 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcgctcgcgt |
tRNA gene sequence |
GCGGACGTGGCGGAACTGGTAGACGCGCAGGTCTCAGAAGCCTGTTCCCGCAAGGGAGTG |
Downstream region at tRNA end position |
atttcctaac |
Secondary structure (Cloverleaf model) | >WENV180097396 Leu CAG t ACCA atttcctaac G - C C - G G - C G - C A - T C - G G - C T T T T C T T C A C A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TTCCCGCAAGGGAGT C - G A - T G - C G - C T + G C A T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |