Sequence ID | >WENV180097427 |
Genome ID | MTBK01188291 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 754 |
End posion on genome | 662 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaaaatagtc |
tRNA gene sequence |
GGAGAGGTGTCCGAGCGGCCGAAGGAACCCGACTGGAAATCGGGTAGGCGGCTAAACCCC |
Downstream region at tRNA end position |
acccggtacg |
Secondary structure (Cloverleaf model) | >WENV180097427 Ser GGA c GCCA acccggtacg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | A G G C C T G A G G G C G | | | T T C A G G A C G A A TAGGCGGCTAAACCCCGCCTC C - G C - G C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |