Sequence ID | >WENV180097434 |
Genome ID | MTBK01188391 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1567 |
End posion on genome | 1480 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atcgaattgg |
tRNA gene sequence |
GGAGAGATGACCGAGTTGGAAAGGAGCATGCCTGGAAAGCGTGTAAGGTCGAAAGGCCCC |
Downstream region at tRNA end position |
ttaaatataa |
Secondary structure (Cloverleaf model) | >WENV180097434 Ser GGA g GCCA ttaaatataa G - C G - C A - T G - C A - T G - C A - T T G T C A C C C A T G A G | | | | | G T G C C A G T G G G C G | | T T G A G G A A A G TAAGGTCGAAAGGCCCC C - G A - T T + G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |