Sequence ID | >WENV180097438 |
Genome ID | MTBK01188609 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4477 |
End posion on genome | 4563 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttcaagtgct |
tRNA gene sequence |
GCTCGTGTGGCGGAATCGGCAGACGCAGCGGACTTAAAATCCGCGGGATTCCAATCCATG |
Downstream region at tRNA end position |
gtggaacacc |
Secondary structure (Cloverleaf model) | >WENV180097438 Leu TAA t ACCA gtggaacacc G - C C - G T - A C - G G - C T - A G - C T A T C G G C C A T A A G | | | | | G C G G C G G C C G G C G | | | T T G A C G C C A G A GGGATTCCAATCCAT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |