Sequence ID | >WENV180097461 |
Genome ID | MTBK01190387 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12943 |
End posion on genome | 12869 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
atttttcttc |
tRNA gene sequence |
GGGCTTTTAGCTCAGTCGGTTAGAGCAACAGACTCATAATCTGGAGGTCCTAGGTTCAAG |
Downstream region at tRNA end position |
tggaaatcaa |
Secondary structure (Cloverleaf model) | >WENV180097461 Ile2 CAT c ACac tggaaatcaa G - C G - C G - C C - G T + G T T T - A T G T G A T C C A T G A A | | | | | A C C T C G C T A G G C G | | | | T T G G A G C T T A A AGGTC A G C - G A - T G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |