Sequence ID | >WENV180097473 |
Genome ID | MTBK01191051 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 5516 |
End posion on genome | 5605 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
taatcaagcc |
tRNA gene sequence |
GGAGAGATGCCAGAGCGGTCGAATGGGGCGGTCTCGAAAACCGTTGTCTGCCTTACAGCG |
Downstream region at tRNA end position |
ttatacgatt |
Secondary structure (Cloverleaf model) | >WENV180097473 Ser CGA c GCat ttatacgatt G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A C G A G | | | | | G G G A C C C A G G G C G | | | T T T A T G G C G A G TGTCTGCCTTACAGCGGACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |