Sequence ID | >WENV180097489 |
Genome ID | MTBK01191704 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 592 |
End posion on genome | 689 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tgcctctctc |
tRNA gene sequence |
GGAAGTGCGCAGGTCACTGGTGGGCCTCCTGGACTTCAAATCCAGTGTGGGGGGCTGATA |
Downstream region at tRNA end position |
attgatccga |
Secondary structure (Cloverleaf model) | >WENV180097489 SeC TCA c GCCA attgatccga G - C G - C A - T A - T G - C T - A G - C C - G T T G T A C C C A C A C C + | | | | G T T G G A G T G G G C G + | | | T T G G C C T T G G C TGTGGGGGGCTGATACCCTCCCAG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |