Sequence ID | >WENV180097492 |
Genome ID | MTBK01191802 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1602 |
End posion on genome | 1686 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tatattttat |
tRNA gene sequence |
GCCCGGTTGGCGGAATTGGTAGACGCGCTGGTCTCAAAAACCAGTGGATTAATTTCCTTG |
Downstream region at tRNA end position |
agaaacccct |
Secondary structure (Cloverleaf model) | >WENV180097492 Leu CAA t ACga agaaacccct G + T C - G C - G C - G G - C G - C T - A T T T C G G C C A T A A G | | | | | A T G G C G G C C G G C G | | | T T G A C G C T A G G TGGATTAATTTCCTT C - G T - A G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |