Sequence ID | >WENV180097531 |
Genome ID | MTBK01194363 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4349 |
End posion on genome | 4437 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cttgctggac |
tRNA gene sequence |
GGAGGCGTGTCCGAACAGGCTAAGGAGCCGGTCTCGAAAATCGGTGGACCTTACGGTCCT |
Downstream region at tRNA end position |
ttttatttca |
Secondary structure (Cloverleaf model) | >WENV180097531 Ser CGA c GCCA ttttatttca G - C G - C A - T G - C G - C C - G G - C T G T C A C C C A C A A G | | | | | G A G C C T G T G G G C G | | | T T G A G G A C T A G TGGACCTTACGGTCCTT C - G C - G G - C G + T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |