Sequence ID | >WENV180097552 |
Genome ID | MTBK01195395 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 574 |
End posion on genome | 657 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaaggaattg |
tRNA gene sequence |
GGGCAGTTACCAGAGTGGCCAAATGGGGCAGACTGTAAATCTGCTGGTTGATACCTACGG |
Downstream region at tRNA end position |
attattttta |
Secondary structure (Cloverleaf model) | >WENV180097552 Tyr GTA g ACaa attattttta G - C G - C G - C C - G A - T G - C T - A T A T C T A C C A T G A A | + | | | G G G A C C G G T G G C G | | | T T C A T G G C A A G TGGTTGATACCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |