Sequence ID | >WENV180097560 |
Genome ID | MTBK01196363 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1342 |
End posion on genome | 1256 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttttgtgtg |
tRNA gene sequence |
GCCGGGGTGGCGGAATGGTAGACGCTACGGACTTAAAATCCGTTGGGCTAAGCGCCCGTG |
Downstream region at tRNA end position |
ttattaagaa |
Secondary structure (Cloverleaf model) | >WENV180097560 Leu TAA g ACCA ttattaagaa G - C C - G C - G G - C G - C G - C G + T T G T C T C C C A T A A G | | | | | A G G G C G G A G G G C G | | | T T T A C G C A G T TGGGCTAAGCGCCCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |