Sequence ID | >WENV180097570 |
Genome ID | MTBK01197140 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 258 |
End posion on genome | 342 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tttatttcaa |
tRNA gene sequence |
GCTCAGGTGGCGGAATTGGCAGACGCGATGGACTCAAAATCCATTGATCGTAAGATCATG |
Downstream region at tRNA end position |
ctttaagttt |
Secondary structure (Cloverleaf model) | >WENV180097570 Leu CAA a ACta ctttaagttt G - C C - G T - A C - G A - T G - C G - C T C T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C C A G G TGATCGTAAGATCAT A - T T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |