Sequence ID | >WENV180097582 |
Genome ID | MTBK01198219 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 422 |
End posion on genome | 515 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
gcttagcgat |
tRNA gene sequence |
GGGAATGGTTAGGTCCCGGTGGGCTTCCTGGTCTTCAAAATCAGTGTCGGGTCGCGTTGC |
Downstream region at tRNA end position |
tgattcgagc |
Secondary structure (Cloverleaf model) | >WENV180097582 SeC TCA t Gttt tgattcgagc G - C G - C G - C A - T A - T T - A G - C G - C T C T T A C C C A C C C T + | | | | G G T G G A G T G G G C G + | + | T T T G C T T G G C TGTCGGGTCGCGTTGCGAGCCGGG C - G T - A G - C G + T T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |