Sequence ID | >WENV180097586 |
Genome ID | MTBK01198648 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11985 |
End posion on genome | 11897 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttttcagtT |
tRNA gene sequence |
GGAGAGGTGCGAGAGTGGCCGAATCGGGCTCCCTGCTAAGGAGTTGACCTGGTAACGGGT |
Downstream region at tRNA end position |
tttttacaat |
Secondary structure (Cloverleaf model) | >WENV180097586 Ser GCT T GGat tttttacaat G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G A G C G G G G G C G | | | T T C A T C G C G A G TGACCTGGTAACGGGTCC G + T C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |