Sequence ID | >WENV180097589 |
Genome ID | MTBK01198648 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11670 |
End posion on genome | 11584 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tttgtatttT |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTCGATGGTGCACGCTTGGAAAGCGTGTGTGCCGAGAGGCACC |
Downstream region at tRNA end position |
cccagccaac |
Secondary structure (Cloverleaf model) | >WENV180097589 Ser GGA T GTtt cccagccaac G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G + | | T T T T G G T C G A G TGTGCCGAGAGGCACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |