Sequence ID | >WENV180097591 |
Genome ID | MTBK01198804 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1098 |
End posion on genome | 1014 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cggcttacaT |
tRNA gene sequence |
GCAGAGGTGGCGGAGCGGTCAAACGCATCGGACTGTAAATCCGACTCCTTCGGGATACAC |
Downstream region at tRNA end position |
ctcttttcac |
Secondary structure (Cloverleaf model) | >WENV180097591 Tyr GTA T ATtt ctcttttcac G - C C - G A - T G - C A - T G - C G - C T A T T G A C C A C G A G | | | | | A G G G C G A C T G G C G | | | T T T A C G C C A A A CTCCTTCGGGATAC T - A C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |