Sequence ID | >WENV180097611 |
Genome ID | MTBK01199780 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1243 |
End posion on genome | 1330 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctagcgaaaa |
tRNA gene sequence |
GCCGGGGTGTTGGAACGGGTAGACAATGGGGACTTAAAATCCCCTGGGCTTTGAGCCCGT |
Downstream region at tRNA end position |
ttatttcatc |
Secondary structure (Cloverleaf model) | >WENV180097611 Leu TAA a ACCA ttatttcatc G - C C - G C - G G - C G - C G - C G - C T G T C G C C C A C A A G | | | | | G G G G T T G C G G G C G | | | T T G A C A A T A G T TGGGCTTTGAGCCCGT G - C G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |