Sequence ID | >WENV180097686 |
Genome ID | MTBK01204291 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 14108 |
End posion on genome | 14035 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttgttgagga |
tRNA gene sequence |
TGGGGTGTAGCCAAGCGGCAAGGCAGCGGACTTTGGCTCCGCGATCGCTGGTTCGATTCC |
Downstream region at tRNA end position |
tggataaaca |
Secondary structure (Cloverleaf model) | >WENV180097686 Gln TTG a GCCA tggataaaca T - A G - C G - C G - C G - C T - A G - C T T T C G A C C A G A A | | | | | G C A C C G G C T G G C G | | | T T G A G G C C A A GATC G - C C - G G - C G - C A - T C C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |