Sequence ID | >WENV180097687 |
Genome ID | MTBK01204827 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 17511 |
End posion on genome | 17582 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atacagaaat |
tRNA gene sequence |
GGTTTCGTGGCCGAGTGGCTAGGTAGAGGTCTGCAATACCTTCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaaaagcat |
Secondary structure (Cloverleaf model) | >WENV180097687 Cys GCA t TCaa aaaaaagcat G - C G - C T - A T + G T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | + T T G A G G T C T A CTAC G + T A - T G - C G - C T - A C T T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |