Sequence ID | >WENV180097705 |
Genome ID | MTBK01205432 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 5142 |
End posion on genome | 5071 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgtaaagca |
tRNA gene sequence |
GGGCCCGTAGCTCAGCGGCAGAGCAGGCGGCTCATAACCGCTTGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
gaaacccctt |
Secondary structure (Cloverleaf model) | >WENV180097705 Ile2 CAT a Atgg gaaacccctt G - C G - C G - C C - G C - G C - G G - C T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C C A A TGGTC G + T G - C C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |