Sequence ID | >WENV180097734 |
Genome ID | MTBK01208256 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1336 |
End posion on genome | 1407 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctgagcttgt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACACCTCCTTGCCAAGGAGAAGGTTGAGAGTTCGAGTC |
Downstream region at tRNA end position |
tgaacaacta |
Secondary structure (Cloverleaf model) | >WENV180097734 Gly GCC t Tttt tgaacaacta G - C C - G G - C G - C G - C T + G G - C T G T T T C T C A A A A + | | | | G T C T T G G A G A G C G | | | | T T G G A A C T A A AGGTT C A C - G T - A C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |