Sequence ID | >WENV180097747 |
Genome ID | MTBK01208896 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 611 |
End posion on genome | 698 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cctgcccgtt |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTTGATTGGGGCGGTCTCGAAAACCGTTGTAGCCTTGCGGCTA |
Downstream region at tRNA end position |
ttttgttaag |
Secondary structure (Cloverleaf model) | >WENV180097747 Ser CGA t GCta ttttgttaag G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G A C C G A G G G C G + | | | T T T T T G G T G A G TGTAGCCTTGCGGCTACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |