Sequence ID | >WENV180097752 |
Genome ID | MTBK01209252 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 52300 |
End posion on genome | 52374 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgaaccgcat |
tRNA gene sequence |
GCCCCTATAGCTCAGTCGGTAGAGCTACGGACTTTTAATCCGCAGGTCCCAGGTTCGAGC |
Downstream region at tRNA end position |
ggatacgaac |
Secondary structure (Cloverleaf model) | >WENV180097752 Lys TTT t ACCg ggatacgaac G - C C - G C - G C - G C - G T + G A - T C G T G G T C C A T G A A | | | | | G C C T C G C C A G G C G | | | | T T G G A G C T A T AGGTC A C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |