Sequence ID | >WENV180097753 |
Genome ID | MTBK01209252 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 111110 |
End posion on genome | 111183 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cggcggccag |
tRNA gene sequence |
GCCTCCTTAGCTCAGTGGTAGAGCACTCGCCTTGTAAGCGAAAGGTCGTCAGTTCAATCC |
Downstream region at tRNA end position |
cgcctcaccc |
Secondary structure (Cloverleaf model) | >WENV180097753 Thr TGT g TCCg cgcctcaccc G - C C - G C - G T + G C - G C - G T - A C T T C A G T C A G A A | | | | | A T C T C G G T C A G C G | | | | T T G G A G C T A A AGGTC C A T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |