Sequence ID | >WENV180097760 |
Genome ID | MTBK01209395 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 137 |
End posion on genome | 219 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cagagtcgtt |
tRNA gene sequence |
GCATCAGTGGCGGAATAGGCAGACGCGCACGCTTGAGGGGCGTGTGGGCAACCGTACGGG |
Downstream region at tRNA end position |
aatttaggaa |
Secondary structure (Cloverleaf model) | >WENV180097760 Leu GAG t ACCA aatttaggaa G - C C - G A - T T - A C - G A - T G - C T G T T G C C C A T A A G | | | | | A A G G C G A C G G G C G | | | T T G A C G C C A G G TGGGCAACCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |