Sequence ID | >WENV180097764 |
Genome ID | MTBK01209749 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1607 |
End posion on genome | 1514 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
nnnnnnnagt |
tRNA gene sequence |
GGGAGCAGATGGAAGACTGGTGTTGCCCTTGGACTTCAAATCCAATGACAGGCTTAGGGT |
Downstream region at tRNA end position |
tcttaaaggc |
Secondary structure (Cloverleaf model) | >WENV180097764 SeC TCA t GCCA tcttaaaggc G - C G - C G - C A - T G - C C - G A - T G A T T A C A C C C A C A G T | | | | | G T A A G G G T G G G C G | | | T T G T G C C T G T C TGACAGGCTTAGGGTCTGTG T - A T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |