Sequence ID | >WENV180097767 |
Genome ID | MTBK01209857 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3079 |
End posion on genome | 3007 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
agggcagatt |
tRNA gene sequence |
GCCGCTGTGGCTTAGTGGTATAGCGGCTGATTCGTAATCAGCAGGTCGAGGGTTCAATCC |
Downstream region at tRNA end position |
gaaatgttac |
Secondary structure (Cloverleaf model) | >WENV180097767 Thr CGT t TCta gaaatgttac G - C C - G C - G G - C C - G T - A G - C C T T C T C C C A G A G | | | | | A T T T C G G A G G G C G | | | T T G T A G C T A G AGGTC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |