Sequence ID | >WENV180097780 |
Genome ID | MTBK01210861 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 86 |
End posion on genome | 1 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttcgcgttcT |
tRNA gene sequence |
GCGGAAGTGGTGGAATTGGTAGACGCGCTAGGTTCAGGACCTAGTGGGTGCAAACCTGTG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180097780 Leu CAG T ATnn nnnnnnnnnn G - C C - G G - C G - C A - T A - T G - C T G T C C C C C A T A A G | | | | | G T G G T G G G G G G C G | + | T T G A C G C T A G G TGGGTGCAAACCTGT C - G T - A A - T G - C G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |