Sequence ID | >WENV180097786 |
Genome ID | MTBK01211139 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 921 |
End posion on genome | 1006 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cagaaatttt |
tRNA gene sequence |
GGACAGGTGGTCGAGTGGTTAATGGCACTGGGCTGTAAACCCAGCGACGAAAGTCTACGG |
Downstream region at tRNA end position |
tttatagcnn |
Secondary structure (Cloverleaf model) | >WENV180097786 Tyr GTA t ACCA tttatagcnn G - C G - C A - T C - G A - T G - C G - C T A T C T T C C A T G A G | + | | | G G G C T G G G A G G C G + | + | T T T T G G C T A A A CGACGAAAGTCTAC C - G T - A G - C G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |