Sequence ID | >WENV180097820 |
Genome ID | MTBK01212838 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1648 |
End posion on genome | 1566 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtagcattca |
tRNA gene sequence |
GCCGAAGTGATGGAATGGCAGACGTGACGGACTCAAAATCCGTTGGTGGCAACACCGTGT |
Downstream region at tRNA end position |
ttccaacaaa |
Secondary structure (Cloverleaf model) | >WENV180097820 Leu CAA a Ataa ttccaacaaa G - C C - G C - G G - C A - T A - T G - C T A T C A C C C A T A A G | | | | | A G G G T A G T G G G C G | + | T T C A C G T A G G TGGTGGCAACACCGT A - T C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |