Sequence ID | >WENV180097823 |
Genome ID | MTBK01212898 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 907 |
End posion on genome | 819 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cctggtccaC |
tRNA gene sequence |
GGTGACGTGTCTGAGCGGCCGAAAGAGCTCGCCTCGAAAGCGAGTGTGGTGCAAGCCACC |
Downstream region at tRNA end position |
gtgatgtcga |
Secondary structure (Cloverleaf model) | >WENV180097823 Ser CGA C GCCC gtgatgtcga G - C G - C T - A G - C A - T C - G G - C T A T C T C C C A C G A G | | | | | A G G T C T G A G G G C G | | | T T C A A G A C G A G TGTGGTGCAAGCCACC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |