Sequence ID | >WENV180097826 |
Genome ID | MTBK01213305 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1756 |
End posion on genome | 1683 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
atgtaaacaa |
tRNA gene sequence |
CGGGGCGTAGTGCAGAGGCTAACACGCAGCGTTCGGGACGCTGAGATCGTGGGTTCAAAT |
Downstream region at tRNA end position |
aataatatta |
Secondary structure (Cloverleaf model) | >WENV180097826 Pro CGG a ACtt aataatatta C - G G - C G - C G - C G - C C A G - C T A T C A C C C A A G A A | | | | | A G C G T G G T G G G C G | | | T T C A C A C T A G AGATC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |