Sequence ID | >WENV180097852 |
Genome ID | MTBK01214647 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 478 |
End posion on genome | 396 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aaaatcttta |
tRNA gene sequence |
GCGCGGGTGGCGGAACTGGTAGACGCGCTAGCCTAAGGAGCTAGTGCCGCAAGGCATGGA |
Downstream region at tRNA end position |
aatttaacta |
Secondary structure (Cloverleaf model) | >WENV180097852 Leu AAG a ACtt aatttaacta G - C C - G G - C C - G G - C G - C G - C T A T T C T C C A C A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C T A G G TGCCGCAAGGCAT C - G T - A A - T G - C C - G C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |