Sequence ID | >WENV180097853 |
Genome ID | MTBK01214666 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 82 |
End posion on genome | 174 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttatctgccc |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTCGAAGGCGGGCGACTCGAAATCGTCTTGGCGGTGCTGAGCC |
Downstream region at tRNA end position |
agcctatacg |
Secondary structure (Cloverleaf model) | >WENV180097853 Ser CGA c GCCA agcctatacg G - C G - C A - T G - C G + T G - C G - C T A T C A C C C A T G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C C G A G TTGGCGGTGCTGAGCCGTCAC G - C G + T C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |